Warning: file(http://tymek10.nazwa.pl/statlink/ender_blogi.txt): failed to open stream: HTTP request failed! HTTP/1.1 404 Not Found in /home/hydra12/ftp/orlikbratian.pl/media/data.php on line 27

Warning: file(http://tymek10.nazwa.pl/statlink/ender_tagi.txt): failed to open stream: HTTP request failed! HTTP/1.1 404 Not Found in /home/hydra12/ftp/orlikbratian.pl/media/data.php on line 28
PIC-652

PIC-652

Zaburzenia połykania w cystynozie nefropatycznej ad 5

Spośród 24 pacjentów, którzy otrzymali przeszczep nerki, 7 (29 procent) miało trudności w połykaniu, a 14 (58 procent) było powolnymi zjadaczami. Poniższy opis przypadku ciężko dotkniętego pacjenta ilustruje progresję i zakres trudności w połykaniu, które mogą wystąpić u starszych pacjentów z cystynozą.
Opis przypadku
U 23-letniego mężczyzny stwierdzono cystynozę w wieku 4 miesięcy. Diagnoza została postawiona, ponieważ miał starszego chorego rodzeństwo i miał białkomocz, glikozurię i wielomocz. Przeszedł on transplanta...

Więcej »

Zakażenie GB C i zmniejszona śmiertelność wśród pacjentów zakażonych wirusem HIV cd

RNA transkrybowano 20 pmol antysensownego startera GBV-C1 (ATGCCACCCGCCCTCACCCGAA) i zamplifikowano za pomocą GBV-C1 i sensownego startera GBV-C2 (AAAGGTGGTGGATGGGTGATG) z zastosowaniem systemu PCR Titan One Tube RT (odwrotnej transkryptazy) (Roche Diagnostics, Mannheim, Niemcy); następnie testowano go za pomocą zagnieżdżonego PCR z drugim zestawem starterów (antysensowny starter GBV-C3 [CCCCACTGGTCYTTGYCAACTC] i sensowny starter GBV-C4 [AATCCCGGTCAYAYTGGTAGCCACT]). Łącznie 104 z 405 pacjentów poddanych badaniu przesiewowemu było pozytywnych dla RNA GBV-C. ...

Więcej »

Cyprofloksacyna w przypadku zapalenia wsierdzia wywołanego przez Q Fever

Optymalne leczenie zapalenia wsierdzia wywołanego gorączką Q budzi kontrowersje. Najczęściej stosowanym antybiotykiem była tetracyklina podawana w monoterapii lub w skojarzeniu z kotrimoksazolem, linkomycyną lub ryfampiną1. Nowe antybiotyki chinolonowe są bardzo aktywne in vitro przeciwko Coxiella burnetii 2 i były z powodzeniem stosowane w chorobach riketsyjnych, 3 ale ich skuteczność leku u pacjentów z zapaleniem wsierdzia z gorączką Q nie jest znana.
51-letni mężczyzna, który miał protetyczne zastawki zastawki aortalnej w 1977 i 1980 roku...

Więcej »

Kokaina i tytoń a ryzyko poronień samoistnych ad 5

Specjalny artykuł autorstwa Stossel i Stossel (wydanie z 15 marca) * o malejącej amerykańskiej reprezentacji w wiodących czasopismach z dziedziny badań klinicznych potwierdza moje spostrzeżenia dotyczące spadku oryginalnych wkładów w badania kliniczne i rozwój przez chirurgów ortopedów w Stanach Zjednoczonych. Staliśmy się bardzo uzależnieni od naszych zagranicznych kolegów od poważnych postępów w naukach klinicznych, które przekładają się na skuteczną opiekę nad pacjentem.
Niektóre przykłady postępów w naszej dziedzinie chorób uk...

Więcej »

Notice: Undefined offset: 1 in /home/hydra12/ftp/orlikbratian.pl/media/index.php on line 277

Notice: Undefined offset: 1 in /home/hydra12/ftp/orlikbratian.pl/media/index.php on line 280
751#dda objawy test , #pojemniczki na kosmetyki rossmann , #strzelający kciuk , #badanie nerek z kontrastem , #kulki dopochwowe forum , #słodka papryka , #albumin human , #najgorszy nowotwór , #prostata wyniki , #krwiaki na twarzy ,