Zakażenie GB C i zmniejszona śmiertelność wśród pacjentów zakażonych wirusem HIV cd

RNA transkrybowano 20 pmol antysensownego startera GBV-C1 (ATGCCACCCGCCCTCACCCGAA) i zamplifikowano za pomocą GBV-C1 i sensownego startera GBV-C2 (AAAGGTGGTGGATGGGTGATG) z zastosowaniem systemu PCR Titan One Tube RT (odwrotnej transkryptazy) (Roche Diagnostics, Mannheim, Niemcy); następnie testowano go za pomocą zagnieżdżonego PCR z drugim zestawem starterów (antysensowny starter GBV-C3 [CCCCACTGGTCYTTGYCAACTC] i sensowny starter GBV-C4 [AATCCCGGTCAYAYTGGTAGCCACT]). Łącznie 104 z 405 pacjentów poddanych badaniu przesiewowemu było pozytywnych dla RNA GBV-C. Co najmniej jedna próbka osocza, która została uzyskana po rejestracji (pomiędzy 1996 a 1999) i przechowywana w temperaturze -80 ° C, była dostępna do oznaczenia ilościowego GBV-C od 72 pacjentów z 104 GBV-C. Łącznie 169 próbek z tych 72 pacjentów poddano analizie ilościowej za pomocą testu DNA z rozgałęzionym łańcuchem (bDNA) (Figura 1), a wyniki porównano z liczbą komórek CD4 + i obciążeniami HIV (obliczonymi w tym samym czasie) w celu określenia czy wyższy ładunek GBV-C skorelowany z wyższą liczbą komórek CD4 + lub niższym obciążeniem HIV. Obciążenie GBV-C określono za pomocą prototypowego testu bDNA GBV-C w Bayer Reference Testing Laboratory w Mijdrecht, Holandia. Format jest podobny do testu Bayer HCV bDNA 3.0. Sondy swoiste dla celu, stosowane do ułatwienia wychwytywania i znakowania RNA GBV-C, znajdują się w stosunkowo konserwatywnych sekwencjach nieulegającego translacji regionu 5 genomu GBV-C.11 Poprzez szereg zdarzeń hybrydyzacji, wiele bDNA i zasadowych znakowane fosfatazą cząsteczki oligonukleotydowe są związane z docelową cząsteczką RNA GBV-C. Dodanie substratu, który można wyzwolić przez enzym, powoduje, że sygnał jest proporcjonalny do ilości docelowego RNA dodanego. Wynik kwantyfikacji próbki jest określany przez interpolację z krzywej standardowej, a wyniki są podawane w kopiach na mililitr. Dolna granica wykrywalności dla tego prototypowego testu bDNA wynosi 67 000 kopii na mililitr.
Limfocyty CD4 + i CD8 + zmierzono za pomocą sortowania komórek aktywowanych fluorescencyjnie (FACScalibur, Becton Dickinson, Heidelberg, Niemcy), a obciążenie HIV określono półilościowo za pomocą komercyjnego testu PCR (Amplicor HIV-1 Monitor, Roche Diagnostics, Bazylea, Szwajcaria).
Analiza statystyczna
Do analizy zmiennych jakościowych użyto chi-kwadrat lub dokładny test Fishera. Środki grupowe zostały porównane za pomocą testu t-Studenta lub testu U Manna-Whitneya, testu sumy rang Wilcoxona lub testu Kruskala-Wallisa, jeśli to właściwe. Łączne przeżycie i czas przeżycia bez AIDS oceniano za pomocą analizy Kaplana-Meiera. Równość rozkładów przeżycia oceniano za pomocą testu log-rank. Model regresji proporcjonalnego hazardu Coxa zastosowano do analizy zmiennych ciągłych, takich jak wiek, liczba komórek CD4 + i obciążenie wirusem HIV, a także do oszacowania współczynników ryzyka za pomocą modelu wieloczynnikowego obejmującego kategorie płci, wieku, CD4 + liczba komórek, liczba komórek CD8 +, znany czas trwania zakażenia HIV, obciążenie HIV i status GBV-C (RNA-dodatni, anty-E2-dodatni lub bez markera ekspozycji na GBV-C). Pacjenci, którzy stracili czas do obserwacji, zostali włączeni do analiz, ale dane zostały ocenzurowane w czasie ostatniej wizyty
[patrz też: szczepionka rekombinowana, endometrioza a in vitro, autologiczny przeszczep komórek macierzystych ]
[przypisy: gastromed garwolin, hipoglikemia noworodka, gastrolog garwolin ]