Przegląd raka piersi: społeczeństwo kształtuje epidemię

W swojej recenzji naszej książki Breast Cancer: Society Shapes a Epidemic (26 kwietnia), główną krytyką Spiegel jest to, że określamy raka piersi jako chorobę medyczną lub problem społeczny. Żadna taka fałszywa dychotomia nigdy nie była zamierzona. W rzeczywistości zgadzamy się ze Spiegelem, który mówi: Oczywiście, że jest to jedno i drugie . Chcieliśmy jednak zwrócić uwagę na społeczne aspekty raka piersi, ponieważ tak niewiele napisano na ten temat. Pozostaje nam wierzyć, że wszystkie choroby można postrzegać zarówno z perspektywy społecznej, jak i medycznej, i nie jesteśmy ani sami, ani nowi. Continue reading „Przegląd raka piersi: społeczeństwo kształtuje epidemię”

Chemioradioterapia po zabiegach chirurgicznych w porównaniu z zabiegami chirurgicznymi z powodu gruczolakoraka żołądka lub połączenia żołądkowo-przełykowego ad

Badanie rozpoczęto w 1991 r. W celu porównania operacji operowanej z fluorouracylem oraz napromienianiem żołądka i regionalnych węzłów chłonnych z samą operacją. Metody
Wybieralność
Kryteria kwalifikacji obejmowały histologicznie potwierdzony gruczolakorak żołądka lub połączenie żołądkowo-przełykowe; całkowita resekcja nowotworu, zdefiniowana jako resekcja wykonana z celem leczniczym i skutkująca resekcji całego guza z marginesami badania resekcji ujemnego dla raka; klasyfikacja wyciętego gruczolakoraka żołądka lub połączenia żołądkowo-przełykowego jako stadium IB do IVM0 zgodnie z kryteriami z 1988 r. Amerykańskiej Komisji Mieszanej ds. Raka15; status wydajności 2 lub niższy zgodnie z kryteriami Southwest Oncology Group; odpowiednia funkcja głównych narządów (wskazana przez stężenie kreatyniny nie więcej niż o 25% wyższe niż górna granica normy, hemogram w granicach normy, stężenie bilirubiny nie więcej niż o 50% wyższe niż górna granica normy, stężenie asparaginianu w surowicy stężenie aminotransferazy nie więcej niż pięć razy powyżej górnej granicy normy, a stężenie fosfatazy alkalicznej nie więcej niż pięć razy powyżej górnej granicy normy); spożycie kaloryczne większe niż 1500 kcal na dzień przez żywienie doustne lub jelitowe; rejestracja między 20 a 41 dniem po operacji, z rozpoczęciem leczenia w ciągu 7 dni roboczych po rejestracji; oraz zapewnienie pisemnej świadomej zgody zgodnie z wytycznymi instytucjonalnymi i federalnymi. Continue reading „Chemioradioterapia po zabiegach chirurgicznych w porównaniu z zabiegami chirurgicznymi z powodu gruczolakoraka żołądka lub połączenia żołądkowo-przełykowego ad”

Zakażenie GB C i zmniejszona śmiertelność wśród pacjentów zakażonych wirusem HIV cd

RNA transkrybowano 20 pmol antysensownego startera GBV-C1 (ATGCCACCCGCCCTCACCCGAA) i zamplifikowano za pomocą GBV-C1 i sensownego startera GBV-C2 (AAAGGTGGTGGATGGGTGATG) z zastosowaniem systemu PCR Titan One Tube RT (odwrotnej transkryptazy) (Roche Diagnostics, Mannheim, Niemcy); następnie testowano go za pomocą zagnieżdżonego PCR z drugim zestawem starterów (antysensowny starter GBV-C3 [CCCCACTGGTCYTTGYCAACTC] i sensowny starter GBV-C4 [AATCCCGGTCAYAYTGGTAGCCACT]). Łącznie 104 z 405 pacjentów poddanych badaniu przesiewowemu było pozytywnych dla RNA GBV-C. Co najmniej jedna próbka osocza, która została uzyskana po rejestracji (pomiędzy 1996 a 1999) i przechowywana w temperaturze -80 ° C, była dostępna do oznaczenia ilościowego GBV-C od 72 pacjentów z 104 GBV-C. Łącznie 169 próbek z tych 72 pacjentów poddano analizie ilościowej za pomocą testu DNA z rozgałęzionym łańcuchem (bDNA) (Figura 1), a wyniki porównano z liczbą komórek CD4 + i obciążeniami HIV (obliczonymi w tym samym czasie) w celu określenia czy wyższy ładunek GBV-C skorelowany z wyższą liczbą komórek CD4 + lub niższym obciążeniem HIV. Obciążenie GBV-C określono za pomocą prototypowego testu bDNA GBV-C w Bayer Reference Testing Laboratory w Mijdrecht, Holandia. Continue reading „Zakażenie GB C i zmniejszona śmiertelność wśród pacjentów zakażonych wirusem HIV cd”

Wpływ sympatycznego odrodzenia na sprawność serca po transplantacji serca ad

Określiliśmy ilościowo obecność i zakres ponownego przywracania współczucia, wykorzystując tomografię emisyjną pozytronową (PET) z analogiem katecholoaminy [11C] hydroksyefedryną, która jest pobierana i przechowywana w presynaptycznych zakończeniach nerwu sympatycznego. Następnie zbadaliśmy związek pomiędzy reinerwacją i funkcją aloprzeszczepu w spoczynku i podczas wysiłku, stosując nieinwazyjne obrazowanie przy użyciu angiografii radionuklidów. Metody
Projekt badania
Przebadaliśmy 29 bezobjawowych, poza tym zdrowych biorców przeszczepów serca (6 kobiet i 23 mężczyzn). Ich średni wiek (. SD) wynosił 56 . Continue reading „Wpływ sympatycznego odrodzenia na sprawność serca po transplantacji serca ad”

Wpływ koinfekcji wirusem GB C na przeżycie wśród pacjentów z zakażeniem wirusem HIV ad

Opisali związek między wiremią GBV-C a przedłużonym przeżyciem w badaniu z udziałem 33 osobników, którzy zostali zakażeni HIV i GBV-C oraz 164 osób zakażonych HIV bez zakażenia GBV-C.1 Następnie trzy inne badania wykazały również lepsze przeżycie wśród 69 pacjentów. osoby zakażone GBV-C i HIV (46 osób z hemofilią i 23 osobami bez hemofilii) niż wśród 404 osób zakażonych HIV bez zakażenia GBV-C.2-4 W jednym badaniu wyniki te okazały się niezależne od wieku, HIV obciążenia, obciążenia HCV, liczby limfocytów T CD4 + i CD8 + oraz genotypu CC receptora 5 chemokiny 5 (CCR5) (coreceptor HIV) 4 Próbowaliśmy ustalić, czy zakażenie GBV-C było związane z przedłużonym przeżyciem w dużej populacji osób zakażonych wirusem HIV, które nabyły wirusa HIV różnymi sposobami transmisji. Ponadto ocenialiśmy hodowle komórek jednojądrzastych krwi obwodowej zainfekowanych zarówno HIV, jak i GBV-C, aby ustalić, czy infekcja GBV-C zmienia in vitro replikację HIV.
Metody
Ocena kliniczna
Oceniliśmy kolejnych pacjentów, którzy byli leczeni w naszej klinice HIV od kwietnia 1988 r. Do czerwca 1999 r., Jeśli udzielili pisemnej świadomej zgody i dostarczyli próbki krwi wystarczające do celów badania. Continue reading „Wpływ koinfekcji wirusem GB C na przeżycie wśród pacjentów z zakażeniem wirusem HIV ad”

Angioma komórek lędźwiowych jako przyczyna powiększenia śledziony

Angioma komórek lędźwiowych jest rzadkim pierwotnym nowotworem śledziony1. Uważany za łagodny stan, naczyniak naczyniowokomórkowy powstaje z normalnych komórek litoralnych wyściełających kanały zatokowe czerwonej miazgi śledziony.
Rysunek 1. Rysunek 1. Udoskonalone tomograficzne badanie tomograficzne pokazujące powiększoną śledzionę z wieloma masami guzkowymi o niskim tłumieniu. Continue reading „Angioma komórek lędźwiowych jako przyczyna powiększenia śledziony”

Wielkie wady w medycynie: dziesięć najsilniejszych sporów w historii

Zasypane czasopismami medycznymi, otoczone przez media z reporterami zdrowia i nauki, bombardowane zaproszeniami na konferencje i usidlone w sieci World Wide Web, lekarze i opinia publiczna zaczęli oczekiwać, że odkrycia medyczne i przełomowe zjawiska będą nieustannie pojawiać się i być natychmiast włączane do praktyka kliniczna lub dalsze badania. Hal Hellman, autor popularnej nauki, dostarczył cennej usługi w swojej nowej książce Great Feuds in Medicine, ujawniającej, jak trudne może być tworzenie i rozpowszechnianie innowacyjnych informacji medycznych. Hellman zgromadził 10 rozdziałów historii medycznej, serię kontrowersyjnych przypadków z jakimś specjalnym dramatem lub zainteresowaniem naukowym , aby podkreślić ludzkie przedsięwzięcie odkryć medycznych. Jego opowieści obejmują szeroki zakres czasu, od prac Harveya na początku XVII wieku po badania nad ludzkim wirusem niedoboru odporności w latach 80. XX wieku, a także szeroki zakres dyscyplin, w tym fizjologię, mikrobiologię, neuronaukę, psychiatrię i biologii molekularnej. Continue reading „Wielkie wady w medycynie: dziesięć najsilniejszych sporów w historii”

Porównanie lorazepamu, diazepamu i placebo w leczeniu stanu pozaszpitalnego Epilepticus czesc 4

Czasy były cenzurowane po przybyciu na oddział ratunkowy (jeśli trwały drgawki) lub kiedy podano pozaszpitalne leczenie lekami otwartymi (jak miało to miejsce w przypadku dwóch pacjentów w grupie placebo i dwóch pacjentów w grupie diazepamu). Wynik neurologiczny po wypisaniu ze szpitala oceniano w odniesieniu do stanu linii podstawowej pacjenta i sklasyfikowano jako stan niezmieniony, stan charakteryzujący się nowymi deficytami neurologicznymi lub śmiercią. Miejsce, do którego pacjent został przeniesiony z pogotowia ratunkowego lub zwolnienie lub śmierć pacjenta, zostało również wybrane jako drugorzędowy punkt końcowy. Ponieważ poprzednie badania wykazały, że przyczyną stanu padaczkowego jest ważna determinantka wyniku, przypisaliśmy pacjentów do trzech grup prognostycznych (dobra, średnia i słaba) w zależności od przyczyny stanu padaczkowego.7,8 Tymczasowe analizy bezpieczeństwa
Tymczasowe analizy bezpieczeństwa przeprowadzono po włączeniu 25, 50, 100 i 150 pacjentów. Procedura O Brien-Fleming została zastosowana do każdego porównania aktywnych metod leczenia i placebo przy użyciu dwustronnego poziomu alfa 0,025.9 Wtórne analizy zostały przeprowadzone z korektą dla współzmiennych. Continue reading „Porównanie lorazepamu, diazepamu i placebo w leczeniu stanu pozaszpitalnego Epilepticus czesc 4”

zastosowanie czosnku niedźwiedziego cd

Każda żyłka została zligowana co najmniej raz. W dolnym przełyku umieszczono do ośmiu pasm na sesję. Sesje przeprowadzono w czasie randomizacji, w dniu 7, a następnie co dwa do trzech tygodni, aż do zlikwidowania żylaków. Uważano, że żylaki zostały wytępione, gdy zniknęły lub nie można było ich złapać i opatrzyć pasmami ligatora. Trzy miesiące po zlikwidowaniu żylaków przeprowadzano dalszą endoskopię i dodatkowe sesje podwiązywania przeprowadzono, jeśli żylaki powróciły ponownie; proces ten powtarzano co sześć miesięcy. Continue reading „zastosowanie czosnku niedźwiedziego cd”

Przedoperacyjna radioterapia w połączeniu z całkowitym wycięciem mezorektalnym w przypadku resekcyjnego raka odbytnicy cd

Odwiedziny innych uczestniczących szpitali i specjalistów zostały przeprowadzone przed rozpoczęciem badania, aby zapewnić jakość leczenia w tych ośrodkach. Ze względów logistycznych podczas próby nie przeprowadzono kontroli jakości radioterapii, chirurgii ani badania patologicznego poza Holandią. Analiza statystyczna
Formularze zgłoszeń zostały przesłane do centralnego biura prób, gdzie informacje o formularzach zostały wprowadzone do bazy danych i przeanalizowane za pomocą oprogramowania statystycznego SPSS (wersja 9.0 dla Windows, SPSS, Chicago). Do porównania proporcji zastosowano testy chi-kwadrat. Do porównania zmiennych ilościowych i porządkowych zastosowano testy Manna-Whitneya. Continue reading „Przedoperacyjna radioterapia w połączeniu z całkowitym wycięciem mezorektalnym w przypadku resekcyjnego raka odbytnicy cd”